gastric inhibitory peptide  (Cusabio)

Journal: Journal of Microbiology and Biotechnology

Article Title: Postbiotic Potential of Heat-Killed Lacticaseibacillus paracasei HP7 in Functional Dyspepsia

doi: 10.4014/jmb.2508.08029

Figure Lengend Snippet: Serum concentrations of ( A ) gastrin (GAS), ( B ) peptide YY (PYY), ( C ) gastric inhibitory peptide (GIP) were measured. Data are presented mean ± SD. Different letters indicate significant differences ( p < 0.05). NOR, normal group; CONT, loperamide injected group; MOS, mosapride-treated group; HP7-L, low-dose heat-killed HP7 treated group (10 8 CFU kg/day); HP7-H, high-dose heat-killed HP7 treated group (10 9 CFU/kg/day).

Article Snippet: The level of regulatory hormones such as gastrin (GAS, CSB- E12924 ; CUSABIO, USA), gastric inhibitory peptide (GIP, CSB-E08486m), and peptide YY (PYY, CSB-EL019128MO) in the serum were quantified according to the manufacturer’s instructions.

Techniques: Injection

Journal: eLife

Article Title: Effector membrane translocation biosensors reveal G protein and βarrestin coupling profiles of 100 therapeutically relevant GPCRs

doi: 10.7554/eLife.74101

Figure Lengend Snippet:

Article Snippet: Chemical compound, drug , Gastric Inhibitory Peptide (GIP) , Bachem , Cat. #: H-5645 , .

Techniques: Functional Assay, Transfection, Construct, Plasmid Preparation, Software, Inverted Microscopy

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: The Effects of Fecal Microbiota Transplantation on the Symptoms and the Duodenal Neurogenin 3, Musashi 1, and Enteroendocrine Cells in Patients With Diarrhea-Predominant Irritable Bowel Syndrome

doi: 10.3389/fcimb.2021.524851

Figure Lengend Snippet: Densities of enteroendocrine cells in the duodenum of controls, total IBS group, PI-IBS, and idiopathic IBS patients before and after receiving FMT.

Article Snippet: The primary antibodies that were diluted according to the suppliers’ recommendations were as follows: polyclonal rabbit anti-synthetic peptide conjugated to keyhole limpet hemocyanin derived from within residues 1–100 of human Msi-1 (code ab21628, Abcam, Cambridge, United Kingdom), monoclonal mouse-anti-protein expressed in 293T cells transfected with human NEUROG3 expression vector (code ab87108, Abcam), monoclonal mouse antibody raised against the N-terminal of purified CgA (code no. M869, Dako, Glostrup, Denmark), polyclonal rabbit anti-human secretin for the detection of secretin (code no. sc-20938, Santa Cruz Biotechnology, Santa Cruz, CA, United States), rabbit antibodies for the detection of cholecystokinin (CCK; code no. A0568, Dako, Glostrup, Denmark), mouse antibodies against human synthetic gastric inhibitory peptide (GIP; code no. sc-57162, Santa Cruz Biotechnology), mouse antibodies against serotonin (code no. R87104 B56-1, Dako), and rabbit antibodies against synthetic cyclic somatostatin (code no. A0566, Dako).

Techniques: Control

Journal: Physiological Reports

Article Title: Prenatal over‐ and undernutrition differentially program small intestinal growth, angiogenesis, absorptive capacity, and endocrine function in sheep

doi: 10.14814/phy2.14498

Figure Lengend Snippet: Primer sequences of the genes studied and the primer origin

Article Snippet: Pro Gastric Inhibitory Peptide (ProGIP) , AGTGACTACAGTATCGCCATG , CCTCTGGGTGATGTTGTGTAT , PrimerDesign Ltd (copyright).

Techniques:

Journal: Physiological Reports

Article Title: Prenatal over‐ and undernutrition differentially program small intestinal growth, angiogenesis, absorptive capacity, and endocrine function in sheep

doi: 10.14814/phy2.14498

Figure Lengend Snippet: Impacts of pre‐ and postnatal nutrition on mRNA expression of genes involved in growth hormones and endocrine/incretin effects in the small intestine (duodenum, jejunum, and ileum). (a) GH‐R (growth hormone receptor), (b) IGF‐1 (insulin‐like growth factor 1), (c) IGF‐1R (insulin‐like growth factor 1 receptor), (d) IRS‐1 (insulin receptor substrate 1); (e) ProGlucagon , and F. ProGIP (pro‐gastric inhibitory peptide). Values are displayed according to any overall significant effects of pre‐ or postnatal nutrition as well as their interactions as detected in the fixed effects test (see p ‐values below regions) within intestinal regions. (a–c) Significantly different between treatment groups (post hoc test) within intestinal regions. For NORM, LOW, HIGH, CONV, and HCHF, see legends to Figure . For ED and LD, see legends to Figure . Data are reported as least square (LS) means with 95% confidence limits (Cl, vertical bars) and represent normalized expression values according to the internal standard (calibrator) and relative to the beta‐actin reference gene expression

Article Snippet: Pro Gastric Inhibitory Peptide (ProGIP) , AGTGACTACAGTATCGCCATG , CCTCTGGGTGATGTTGTGTAT , PrimerDesign Ltd (copyright).

Techniques: Expressing, Gene Expression